Ebook The Accidental Homo Sapiens Genetics Behavior and Free Will Ian Tattersall Robert DeSalle Books
Download As PDF : The Accidental Homo Sapiens Genetics Behavior and Free Will Ian Tattersall Robert DeSalle Books
What happens now that human population has outpaced biological natural selection? Two leading scientists reveal how we became who we are―and what we might become.
When you think of evolution, the picture that most likely comes to mind is a straight-forward progression, the iconic illustration of a primate morphing into a proud, upright human being. But in reality, random events have played huge roles in determining the evolutionary histories of everything from lions to lobsters to humans. However, random genetic novelties are most likely to become fixed in small populations. It is mathematically unlikely that this will happen in large ones.
With our enormous, close-packed, and seemingly inexorably expanding population, humanity has fallen under the influence of the famous (or infamous) “bell curve.â€Â Ian Tattersall and Rob DeSalle’s revelatory new book explores what the future of our species could hold, while simultaneously revealing what we didn’t become―and what we won’t become.
A cognitively unique species, and our actions fall on a bell curve as well. Individual people may be saintly or evil; generous or grasping; narrow-minded or visionary. But any attempt to characterize our species must embrace all of its members and so all of these antitheses. It is possible not just for the species, but for a single individual to be all of these things―even in the same day. We all fall somewhere within the giant hyperspace of the human condition that these curves describe.
The Accidental Homo Sapiens shows readers that though humanity now exists on this bell curve, we are far from a stagnant species. Tattersall and DeSalle reveal how biological evolution in modern humans has given way to a cultural dynamic that is unlike anything else the Earth has ever witnessed, and that will keep life interesting―perhaps sometimes too interesting―for as long as we exist on this planet.
Ebook The Accidental Homo Sapiens Genetics Behavior and Free Will Ian Tattersall Robert DeSalle Books
"Read most of the book today. Their main thesis is that most traits and behaviors are not categorical, but instead fall along a spectrum (the bell curve). Furthermore, the significant contribution of genetics comes from the cumulative small effects of hundreds or thousands of individual genes. This means it is incredibly unlikely that we can find the “gene for x†trait or behavior. Now I will detail three things that I really disliked about the book.
1. They characterize sociobiology and evolutionary psychology as “genetic reductionism†(p.72) because the “gene for x†story is mainly fiction. What the authors fail to mention is that evolutionary psychologists do not reduce all behavior to genetics, but instead study how our past adaptations often *partially contribute* to our current unwise behavior. The strawman argument is unconvincing.
2. Free will is only mentioned twice in the entire book. Both times, the actual point the authors make is that we are not purely programmed by our genes. This is not free will, but instead deterministic decision-making based on some combination of genetic and environmental inputs.
3. In the final chapter they make a baseless claim that "the sum total of happiness in the world will continue to be approximately the same as the sum total of misery" (p. 191). THIS IS PURE NONSENSE. I could go on but this is pretty much sums it up."
Product details
|
Tags : The Accidental Homo Sapiens Genetics, Behavior, and Free Will (9781643130262) Ian Tattersall, Robert DeSalle Books,Ian Tattersall, Robert DeSalle,The Accidental Homo Sapiens Genetics, Behavior, and Free Will,Pegasus Books,1643130269,Evolution (Biology),Evolutionary genetics,Evolutionary psychology,ANTHROPOLOGY (SPECIFIC ASPECTS,General Adult,HUMAN EVOLUTION,Non-Fiction,Psychology/General,SCI/TECH,SCIENCE / Life Sciences / Biological Diversity,SCIENCE / Life Sciences / Evolution,SOCIAL SCIENCE / Anthropology / General,Science/Life Sciences - Biological Diversity,Science/Math,Social Science/Anthropology - General,United States
The Accidental Homo Sapiens Genetics Behavior and Free Will Ian Tattersall Robert DeSalle Books Reviews :
The Accidental Homo Sapiens Genetics Behavior and Free Will Ian Tattersall Robert DeSalle Books Reviews
- Read most of the book today. Their main thesis is that most traits and behaviors are not categorical, but instead fall along a spectrum (the bell curve). Furthermore, the significant contribution of genetics comes from the cumulative small effects of hundreds or thousands of individual genes. This means it is incredibly unlikely that we can find the “gene for x†trait or behavior. Now I will detail three things that I really disliked about the book.
1. They characterize sociobiology and evolutionary psychology as “genetic reductionism†(p.72) because the “gene for x†story is mainly fiction. What the authors fail to mention is that evolutionary psychologists do not reduce all behavior to genetics, but instead study how our past adaptations often *partially contribute* to our current unwise behavior. The strawman argument is unconvincing.
2. Free will is only mentioned twice in the entire book. Both times, the actual point the authors make is that we are not purely programmed by our genes. This is not free will, but instead deterministic decision-making based on some combination of genetic and environmental inputs.
3. In the final chapter they make a baseless claim that "the sum total of happiness in the world will continue to be approximately the same as the sum total of misery" (p. 191). THIS IS PURE NONSENSE. I could go on but this is pretty much sums it up. - At first I was a bit circumspect of the idea of a "bell curve" or "chaos theory" being applied to human evolution. But Tattersall and DeSalle's book--and their clear, lucid writing style--definitely explains how we got to be where we are as a species. And it was not a linear process! The part I found most fascinating was the evolution of our modern brain. We have our "reptilian brain," but as our brain evolved, it wasn't a linear, "thought out" process. Rather, our brains evolved certain attributes as they were needed. Adapting to suit needs. So the end result, though singularly remarkable, as rather ad hoc. And such is our species, both physically and behaviorally, as when we think of our brains, the "mind" can't be ignored, either! I came away from the book was a new understanding and curiosity for the rest of their oeuvre.
- Had the authors and the narrator taken a moment to think about it, they might have agreed that reading numbers aloud like 660,543,958,332,979,000 digit....by....painful digit is an insult to their listeners.
A few moments later they are at it again, when the narrator reads text about the 4 letters used to represent the four bases in DNA. The narrator literally reads several sequences aloud like this CGATGGGCTGAACTACGTTTTAGCTCCCTAGGTAC
And we haven't even gotten through the Prologue!
At this point listeners start cussing, or laughing, or perhaps jumping in front of the nearest bus in despair! The disregard for the listener is clear, and contemptible.
I was looking forward to listening since Tattersall in particular has a nice reputation, getting cited occasionally in high quality books on topics related to evolution.
Life is too short for this accidental homo sapiens to waste time and money on this audio book.
Could be a good book -- I'll never know.
